ArticleDecember 28, 2025

Polystyrene Microplastics and Bisphenol A Exposure Worsen Intestinal Injury in Diabetic Mice by Disrupting Gut Microbiota and Metabolites
Click to copy article linkArticle link copied!

Ying Zhang
Ying Zhang
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
More by Ying Zhang
Qiyao Nong
Qiyao Nong
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
More by Qiyao Nong
Yuanyuan Zhang
Yuanyuan Zhang
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
More by Yuanyuan Zhang
Fanfei Meng
Fanfei Meng
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
More by Fanfei Meng
Xinyuan Hao
Xinyuan Hao
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
More by Xinyuan Hao
Yuan Tian
Yuan Tian
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
More by Yuan Tian
Zunjian Zhang
Zunjian Zhang
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
More by Zunjian Zhang
Fengguo Xu*
Fengguo Xu
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
*Email: [email protected]. Tel.: +86-25-83271021. Fax: +86-25-83271021.
More by Fengguo Xu
https://orcid.org/0000-0001-9999-0128
Pei Zhang*
Pei Zhang
Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
Affiliated Jiangning Chinese Medicine Hospital, China Pharmaceutical University, Nanjing 211100, P. R. China
Nanjing Jiangning Hospital of Chinese Medicine, Nanjing 211100, P. R. China
*Email: [email protected]. Tel.: +86-25-83271021. Fax: +86-25-83271021.
More by Pei Zhang

Open PDF Supporting Information (1)

Chemical Research in Toxicology

Cite this: Chem. Res. Toxicol. 2026, 39, 1, 104–116

Click to copy citationCitation copied!

https://doi.org/10.1021/acs.chemrestox.5c00359

Published December 28, 2025

Request reuse permissions

Abstract

Click to copy section linkSection link copied!

Environmental pollutants can induce multiorgan damage, with the digestive tract particularly susceptible. Diabetic enteropathy is a significant complication of type 2 diabetes mellitus (T2D). However, the relationship between environmental pollutant exposure and T2D-associated intestinal injury has not been previously explored. In this study, T2D mice were subjected to polystyrene microplastics (PS-MPs, 100 μg/day, 3 weeks) and bisphenol A (BPA, 100 μg/kg/day, 2 weeks). Metabolomics and 16S rRNA sequencing were used to detect changes in colonic metabolites and gut microbial composition. Caco-2 cells were utilized to investigate the functions of the altered metabolites. Compared to the T2D group, mice exposed to PS-MPs and BPA exhibited shorter colon length and reduced levels of gut barrier proteins ZO-1 and Occludin. Metabolomics analysis revealed that PS-MPs primarily affected colonic long-chain fatty acids (LCFAs) and adenosine metabolism, while BPA disrupted α-ketoisovaleric acid (KIVA) and pyruvic acid (PyrA) homeostasis. Moreover, PS-MPs exposure altered the abundance of Duncaniella and Olsenella, while BPA primarily affected Phocaeicola, Olsenella, and Variovorax. In vitro experiments showed that palmitoleic acid (C16:1), γ-linolenic acid (C18:3), adenosine (Ado), and KIVA promoted the expression of ZO-1 in Caco-2 cells. Our findings provide valuable insights into the impact of environmental pollutants on intestinal injury in T2D, underscoring the importance of environmental contaminant management, particularly in susceptible populations.

This publication is licensed for personal use by The American Chemical Society.

Subjects

1. Introduction

Click to copy section linkSection link copied!

Environmental pollution has been increasingly severe in recent years, posing a significant threat to human health. Microplastics (MPs) and bisphenols, two prominent classes of emerging environmental contaminants, are pervasive in various aspects of daily life. MPs, less than 5 mm in diameter, contaminate aquatic, terrestrial, and atmospheric environments. (1−3) Annually, an estimated 0.8–3 million tons of MPs enter the marine ecosystem, with terrestrial pollution potentially 3 to 10 times higher. MPs have been detected in over 1,300 species across marine and land ecosystems, representing a serious risk to health. (4) Food contact materials, such as teabags and plastic containers, particularly those subjected to microwave heating, contributed to notably high levels of microplastic release into food. (5,6) Unlike traditional pollutants, MPs have been used for centuries and resist biodegradation. PS-MPs are the dominant polymer type (40.5%) in major water systems like the Yangtze River Estuary (7) and possess unique physicochemical properties with a substantial toxicological research foundation, (8,9) making them an appropriate representative for investigating physical pollutant-induced injury.

Bisphenol A (BPA) exemplifies chemical environmental exposure. Despite the introduction of structural analogues (BPS, BPF, BPAF) following regulatory restrictions, BPA remains the most widely produced and detected bisphenol with substantial global production on a massive scale. BPA is prevalent in polycarbonate plastics, epoxy resins, and thermal paper, leading to widespread human exposure. Daily BPA exposure level is estimated at 4.2 μg/kg bw/day in adults and up to 14.7 μg/kg bw/day in children. (10) Consequently, BPA remains the benchmark for evaluating bisphenol toxicity due to its persistently high detection rates in human biological samples compared with newer analogues. It disrupts hormonal systems, affecting the nervous system, reproduction, and metabolism. (11−13) As a lipophilic endocrine disruptor, BPA accumulates in fat-enriched tissues, increasing the risk of obesity and metabolic complications. (14,15) Elevated serum BPA levels have been linked to poorer glycemic control and insulin resistance in type 2 diabetes (T2D) patients. (16)

Environmental contaminants also accumulate in multiple organs, causing significant damage to the gut, liver, kidney, and brain. (8,17,18) The gut is particularly vulnerable due to its feeding behavior. MPs can alter gut microbial composition, damage intestinal mucosa, impair physiological barriers, and promote inflammation. (19−21) Similarly, dietary BPA has been shown to increase colonic permeability, disrupt the chemical and physical barriers, alter microbial diversity and composition, and ultimately lead to gut injury. (22−24) Moreover, it is noteworthy that the sensitivity to environmental pollutant exposure differs across intestinal segments. Unlike the small intestine, the colon sustains a denser bacterial population and a loose mucus layer, which makes it more vulnerable to exogenous toxins. (25−27) However, the effects of environmental contaminant exposure on colon injury in susceptible populations with pre-existing health conditions remain poorly understood.

Diabetes is a growing health challenge characterized by hyperglycemia, chronic low-grade inflammation, and metabolic disorders. According to the International Diabetes Federation (IDF) Diabetes Atlas, approximately 463 million people are currently live with diabetes in 2019, a number expected to reach 700 million by 2045. (28,29) T2D, accounting for over 90% of cases, (28) is associated with multiorgan damage, including diabetic enteropathy. Over 70% of T2D individuals experience gastrointestinal symptoms, (30,31) involving mechanisms such as glycoprotein deposition in microvascular walls and autonomic neuropathy. (32) Importantly, the guts of diabetic patients may be more sensitive to environmental pollutants compared to healthy individuals. (33)

Therefore, this study aimed to investigate gut injury induced by two distinct categories of ubiquitous pollutants (PS-MPs and BPA) within a vulnerable T2D mouse model. Rather than comparing compounds within the same class (e.g., BPA vs BPS), we sought to delineate the differential effects of these two fundamentally different, yet equally pervasive, contaminant types. Our findings indicate that the mild gut injury in T2D mice was markedly aggravated by both exposures. Mechanistically, PS-MPs and BPA acted through distinct pathways, primarily by disrupting metabolic processes and intestinal microbial homeostasis in a compound-specific manner. These results offer novel insights into the potential impact of environmental pollutants on gut health in T2D, providing a theoretical basis for protective strategies against environmental-contaminant-related gut injury in this vulnerable population.

2. Experimental Procedures

Click to copy section linkSection link copied!

2.1. Chemicals and Reagents

Two μm PS-MPs (#6-1-0200, 2.5% w/v) was purchased from BaseLine (Tianjin, China). Bisphenol A (BPA, #B108653) was purchased from Aladdin Biochemical Technology Co., Ltd. (Shanghai, China). Streptozocin (STZ, #S0130) was purchased from Sigma-Aldrich Co. LLC (St. Louis, MO, USA). High-fat diet (HFD, 60 kcal% fat, #D12492) was purchased from Research Diets, Inc. (New Brunswick, NJ, USA). IL-6, IL-1β, and TNF-α antibodies were purchased from Proteintech Group, Inc. (Hubei, China). Chemical derivatization reagents Dns-Cl and HATU were purchased from J&K Chemical Ltd. (Beijing, China) and d₆-Dns-Cl and d₆-Dns-PP were purchased from Wuxi Beita Pharmatech Co., Ltd. (Jiangsu, China). Chemical derivatization reagent Dns-PP was synthesized in-house. HPLC-grade acetonitrile (ACN) and methanol (MeOH) were obtained from Merck (Darmstadt, Germany). Formic acid was purchased from Nanjing Chemical Reagent (Jiangsu, China). Deionized water was produced using a Milli-Q purification system (Millipore, Watford, UK). Myristic acid (C14), pentadecanoic acid (C15), palmitoleic acid (C16:1), γ-linolenic acid (C18:3), adenosine (Ado), pyruvic acid (PyrA), and alpha-ketoisovaleric acid (KIVA) were purchased from Sigma-Aldrich Co. LLC (St. Louis, MO, USA).

2.2. Cell Culture and Treatment

The Caco-2 cell line was obtained from the American Type Culture Collection (Manassas, VA, USA) and cultured in Minimum Essential Medium (MEM) (Gibco, Grand Island, NY, USA) supplemented with 20% fetal bovine serum (FBS; Gibco, Grand Island, NY, USA), 1 mM sodium pyruvate (Gibco, Grand Island, NY, USA) and 1% penicillin-streptomycin (Cytiva, Boston, USA). Cells were maintained at 37 °C in a humidified atmosphere containing 5% CO₂. The Caco-2 cells were identified at Shanghai Biowing Biotechnology Co., Ltd. (Shanghai, China; sample code: 20240515-03).

Caco-2 cell was seeded into 6-well plates with 1.5 × 10⁵ cells/well and adhered overnight. Then, the cell was treated with C14 (Sigma-Aldrich, St. Louis, MO, USA) (20, 100 μM), C15 (Sigma-Aldrich, St. Louis, MO, USA) (20, 100 μM), C16:1 (Sigma-Aldrich, St. Louis, MO, USA) (20, 100 μM), C18:3 (Sigma-Aldrich, St. Louis, MO, USA) (20, 100 μM), Ado (Sigma-Aldrich, St. Louis, MO, USA) (20, 100 μM), KIVA (Sigma-Aldrich, St. Louis, MO, USA) (0.1, 1, 10 μM), or PyrA (Sigma-Aldrich, St. Louis, MO, USA) (0.1, 1, 10 μM) for 48 h.

2.3. Animal Experiments and Dose Selection

2.3.1. Dose Selection

The size and dose of PS-MPs used in this study were based on existing research and estimations of human daily intake. It has been reported that approximately 60% of MPs detected in the commercial fish from Tunisian coasts have diameters within the 1.2–3 μm size range, indicating a significant transfer of MPs into the human diet. (34) For dosing, studies indicate that humans are exposed to an estimated 0.1–5 g of microplastics per person weekly. For a 70 kg adult, this corresponds to a daily intake of 0.2–10.2 mg/kg. (35,36) The equivalent dose for mice is approximately 12.3 times higher, ranging from 2.5 to 125.5 mg/kg/day, which corresponds to approximately 0.075–3.765 mg/day for a 30 g mouse. Based on this, we applied a dose of 100 μg/day of PS-MPs (2 μm) as an average exposure level to assess potential health risks associated with microplastic ingestion, which remains within an environmentally relevant range for human exposure. Estimated daily BPA intake can reach up to 4.2 μg/kg/day in adults and 14.7 μg/kg/day in children, (10) equating to approximately 51.7 and 180.8 μg/kg/day in mice. For assessing short-term toxicity in T2D mice, we used a dose of 100 μg/kg/day, consistent with these estimates.

2.3.2. Animal Experiment

Six-week-old male-specific-pathogen-free (SPF) C57BL/6J mice were purchased from Vital River Laboratory Animal Technology. All mice were housed in a temperature-controlled SPF environment (24 ± 2 °C) and kept on a 12 h light/dark cycle. All of the animal studies and procedures were approved by the Animal Ethics Committee of China Pharmaceutical University (license no.: SYXK 2021-0011, approval no.: 2023-04-006). Animals were allowed to accommodate for 1 week before the experiment.

Mice were randomly divided into two groups: control (n = 10) and T2D (n = 38). Mice in the T2D group were provided with HFD for 8 weeks and treated with STZ (50 mg/kg, i.p.) in citrate buffer (pH 4.6) for five consecutive days. Mice with fast blood glucose (FBG) ≥11.1 mM were considered diabetic mice. The control group was provided with normal diets and an intraperitoneal injection of citrate buffer (pH 4.6).

T2D mice were divided into four groups: BPA-C (n = 6), BPA (n = 6), PS-MPs-C (n = 7), and PS-MPs (n = 9). Mice in the BPA group were treated with BPA (100 μg/kg/day, i.g.) for 2 weeks. Mice in the BPA-C group were gavaged with corn oil as the vehicle of BPA. Mice in the PS-MPs group were treated with PS-MPs (100 μg/day, i.g.) for 3 weeks. Mice in the PS-MPs-C group were gavaged with water as the vehicle of PS-MPs.

2.4. Western Blot Analysis

Proteins were separated by SDS–PAGE on 8–15% gel and transferred to polyvinylidene difluoride (PVDF) membranes (0.2 μm, Millipore, MA, USA). Primary antibodies were incubated at 4 °C overnight. Secondary antibody conjugated to horseradish peroxidase (HRP) (Proteintech Group, Inc., Hubei, China) were incubated approximately 1 h at room temperature. Immunoreactive bands were visualized using an enhanced chemiluminescence (ECL) system (Millipore, MA, USA) on a Tanon 5200 chemiluminescent imaging system (Tanon Science & Technology, Shanghai, China). Relative protein expression was calculated by densitometric analysis using ImageJ software.

2.5. Metabolomics Analysis

Sample preparation, chemical labeling, and instrument settings for the quantification of endogenous metabolites refer to our previous study. (37) Briefly, colon samples (30 mg) were accurately weighed in chilled homogenization tubes. An extraction solvent mixture was added at a concentration of 30 μL/mg tissue. The samples were homogenized using a bead homogenizer and then centrifuged at 14,000g for 10 min at 4 °C. The supernatant was collected, dried, and stored at −80 °C. Subsequently, chemical labeling was performed using Dns-Cl and Dns-PP, after which the labeled samples were subjected to instrumental analysis. LC-MS/MS analysis was conducted on a Shimadzu Nexera UPLC system (Tokyo, Japan) combined with a Shimadzu MS-8060 triple quadrupole mass spectrometer (Tokyo, Japan). Detailed procedures for sample preparation, chemical derivatization, and instrument conditions can be found in the Supporting Information.

2.6. 16S rRNA Gene Sequencing

High-throughput 16S rRNA gene sequencing was conducted by BGI Genomics (Shenzhen, China). In summary, genomic DNA was extracted using the MagPure Stool DNA KF Kit B (MAGEN, Guangzhou, China). The V3–V4 hypervariable regions of the 16S rRNA gene were amplified with primers (338F: ACTCCTACGGGAGGCAGCAG; 806R: GGACTACHVGGGTWTCTAAT) and then purified using DNA magnetic beads (BGI, LB00 V60). The amplicons were quantified, and the equimolar concentrations were normalized and pooled. Sequencing was performed on the DNBSEQ-G400 platform (BGI-Shenzhen, China), producing reads of PE300/250 bases. Finally, sequences with 100% similarity thresholds were grouped into operational taxonomic units (OTUs) by using QIIME2.

2.7. Histopathologic Analysis

Histopathologic analysis was conducted by Nanjing Freethinking Biotechnological Co., Ltd. (Nanjing, China). In brief, colon tissues were fixed in 4% paraformaldehyde for 24 h, followed by a gradient dehydration process. Subsequently, the tissues were embedded in paraffin wax, sectioned using a Leica HistoCore BIOCUT (Wetzlar, Germany), mounted on gelatin-coated slides, and stained with hematoxylin and eosin (H&E) as well as periodic acid-Schiff stain (PAS). Histopathologic changes were then examined under a microscope.

2.8. Statistical Analysis

Statistical analysis was performed using GraphPad Prism 8.0 software (GraphPad Software Inc., San Diego, USA), and the results were presented as mean ± SD. Group comparisons were made using Student’s or Welch’s t test, as appropriate, following validation of variance homogeneity with Bartlett’s test. p < 0.05 was considered significantly different.

3. Results

Click to copy section linkSection link copied!

3.1. T2D Mice Exhibit Mild Gut Injury

To investigate gut injury associated with T2D, we established a T2D mouse model using an HFD and STZ treatment. The results showed that mice in the T2D group exhibited hyperglycemia (FBG ≥ 11.1 mM) (Figure 1A). Moreover, the colon length of T2D mice was significantly reduced, suggesting a gut injury (Figure 1B). Correlation analysis demonstrated a negative correlation between FBG and colon length (r = −0.62, p < 0.01) (Figure 1C). This correlation was found to be stronger for the colon than for other organs, such as the liver, spleen, lung, kidney, and brain (Figure 1D). ZO-1 and occludin are major tight junction proteins that play a central role in maintaining intestinal barrier function. However, we observed no significant differences in the expression of gut tight junction proteins between the T2D group and the control (Figure 1E). Moreover, no significant differences were observed in intestinal inflammation (IL-1β, TNFα) between the two groups (Figure S1A, B). Also, H&E and PAS staining did not show gut barrier injury and inflammatory cell infiltration in the T2D group (Figure 1F). Overall, these results suggest that mild gut injury occurs under the T2D pathological conditions.

Figure 1. T2D mice exhibit mild gut injury. (A) FBG levels and (B) colon length in T2D and control groups (n = 10). (C) Correlation analysis between FBG and colon length. (D) Correlation analysis among FBG, colon length, body weight, and organ coefficients. (E) Protein expression levels of ZO-1 and occludin in the colon (n = 6). (F) Representative images of H&E and PAS staining of colon tissues (n = 3) (100×). Significance levels are indicated as ns (not significant), **p < 0.01, ****p < 0.0001.

3.2. PS-MPs and BPA Exposures Promote Intestinal Injury in T2D Mice

Physical characterization of PS-MPs was determined by Fourier-transform infrared spectroscopy (FTIR), scanning electron microscopy (SEM), and dynamic light scattering (DLC) analysis. The position and number of bands in the FTIR spectrum confirmed that the reagent used was polystyrene (PS) (Figure 2A). SEM images showed that PS-MPs were spherical structures with smooth surfaces and uniform sizes (Figure 2B). The average hydrated particle diameters of three parallel measurements were 1.891 ± 0.17 μm, and the polydispersion index (PDI) was 0.42 ± 0.19, reflecting the uniformity of the particle size distribution (Figure 2C). These results showed that PS-MPs were stable in fresh water without obvious agglomeration.

Figure 2. *PS-MPs* and BPA exposures promote intestinal injury in T2D mice. (A) *PS-MPs* confirmation by Fourier-transform infrared spectroscopy. (B) Scanning electron microscopy of *PS-MPs*. (C) Zeta potentials of the *PS-MPs*. Colon length of (D) *PS-MPs* (n ≥ 7) and (E) BPA group (n = 6). (F) Representative images of H&E and PAS staining of colon tissues (n = 3) (100×, yellow arrows indicate reduced goblet cells and mucus secretion). Intestinal ZO-1 and occludin expression of (G) *PS-MPs* and (H) BPA group (n = 6). Significance levels are indicated as ns (not significant), *p < 0.05, **p < 0.01, and ****p < 0.0001.

To further investigate whether environmental pollutants exacerbate enterotoxicity in a T2D context, we treated T2D mice with PS-MPs or BPA. Treatment with PS-MPs or BPA resulted in a significant reduction in colon length compared to the T2D group (Figure 2D, E), while the coefficients of the heart, liver, spleen, lung, kidney, and brain showed no significant differences (Figure S2A, B). The FBG level was also unaffected by exposure to PS-MPs or BPA (Figure S2C, D). Besides, histological analysis using H&E and PAS staining revealed that exposure to BPA or PS-MPs destroyed the gut mucosal barrier structure, leading to a decrease in goblet cells and mucus secretion (yellow arrow) (Figure 2F). Moreover, the expression levels of tight junction proteins, ZO-1 and occludin, were significantly lower in BPA groups, while they did not significantly decrease in the PS-MPs group (Figure 2G, H). Moreover, levels of inflammatory factors (IL-1β and TNF-α) (Figure S3A–D) and transcription factors involved in cell proliferation and differentiation (KLF4, Elf3) were not changed (Figure S4A, B). These findings suggest that while colonic inflammation and inhibited cell proliferation contribute to intestinal injury, gut barrier damage may play a more central role in PS-MPs/BPA-induced effects among individuals with T2D.

3.3. PS-MPs and BPA Exposures Alter Gut Microbiota in T2D Mice

Gut commensal bacteria have been found to play a crucial role in the regulation of gut injury. To investigate the impact of PS-MPs or BPA on gut microbiota, we conducted a 16S rRNA gene sequencing analysis. The results revealed a decrease in α-diversity in the T2D group, with no significant differences observed in the PS-MPs or BPA group compared to their respective controls (Figure 3A–C). Furthermore, principal coordinate analysis (PCoA) based on unweighted UniFrac distances revealed a distinct separation between the T2D or PS-MPs group and their respective controls, while no significant distinction was observed between the BPA group and its control (Figure 3D–F). These results imply a gut microbial imbalance in T2D mice, with environmental contaminants, particularly PS-MPs, exacerbating intestinal microbiota disturbances.

Figure 3. *PS-MPs* and BPA exposures alter gut microbiota in T2D mice (n = 3). (A–C) Alpha diversity indices of the T2D, *PS-MPs*, and BPA groups. (D–F) PCoA analysis of the T2D, *PS-MPs*, and BPA groups. Linear discriminant analysis effective size (LEfSe) identifying differentially abundant taxa at the genus level between (G) *PS-MPs*-C and *PS-MPs*, and (H) BPA-C and BPA groups. Significance determined with a linear discriminant analysis (LDA) score (log 10) > 2. **p < 0.01.

To identify key bacterial genera influenced by environmental pollutants in T2D mice, we performed a linear discriminant analysis effective size (LEfSe). This revealed significant differences in the abundance of 29, 11, and 5 genera between the T2D vs Control, PS-MPs vs PS-MP-C, and BPA vs BPA-C groups, respectively (Figures S5 and 3G,H). We further examined the genera that were significantly altered in both the pollutant-exposed and the T2D groups. Notably, g_Duncaniella and g_Olsenella showed significant changes in both the T2D and PS-MPs groups, while g_Phocaeicola, g_Olsenella, and g_Variovorax were altered in both the T2D and BPA groups. Among these, only g_Olsenella consistently decreased in both the T2D and PS-MPs groups, whereas no genus exhibited a consistent directional trend across the T2D and BPA groups. Collectively, these results suggest that exposure to PS-MPs and BPA disrupts intestinal homeostasis and exacerbates gut microbiota dysbiosis through distinct mechanisms in T2D mice.

3.4. PS-MPs and BPA Exposures Induce Colonic Metabolic Dysregulations in T2D Mice

Intestinal metabolic disorder is closely related to environmental pollutant exposure and diabetes. To investigate the metabolic pathways through which PS-MPs and BPA exacerbate intestinal damage, we conducted a metabolomics analysis of the colon. As illustrated in Figure 4A, quality control (QC) samples are tightly clustered, which confirms the instrument stability and methodological reliability. Moreover, intestinal metabolism was significantly disrupted, as demonstrated by a distinct separation in the metabolic profiles among the T2D, PS-MPs, BPA, and their corresponding control groups in the PCA score plots (Figure S6A–C).

Figure 4. *PS-MPs* and BPA exposures induce gut metabolic dysregulations in T2D mice. (A) PCA analysis based on LC-MS metabolomics data. (B, E, H) Pie chart showing the categories of differential metabolites in the T2D (n = 10), *PS-MPs* (n ≥ 7), and BPA (n = 6) groups, respectively. (C, F, I) Volcano plots illustrating differential metabolites in the T2D (n = 10), *PS-MPs* (n ≥ 7), and BPA (n = 6) groups, respectively. (D, G, J) Pathway enrichment analysis of differential metabolites in the T2D (n = 10), *PS-MPs* (n ≥ 7), and BPA (n = 6) groups, respectively.

In the T2D group, 50 differential metabolites were identified, including 22 amino acids, 7 acylcarnitines, 7 nucleotides, 5 organic acids, 4 indole derivatives, 4 fatty acids, and 1 bile acid (Figures 4B, C, S6D, and Table S2). Enrichment analysis revealed differential metabolites were mainly enriched in urea cycle, ammonia recycling, carbohydrate metabolism (citric acid cycle, malate-aspartate shuttle, etc.), and amino acid metabolism (alanine, aspartate, tryptophan metabolism, etc.) (Figure 4D).

In the PS-MPs group, we found 24 differential metabolites, consisting of 13 fatty acids, 4 amino acids, 3 metabolites associated with nucleotide metabolism, 3 organic acids, and 1 bile acid (Figures 4E, F, S6E, and Table S2), which were mainly enriched in fatty acid biosynthesis and metabolism (saturated fatty acids and unsaturated fatty acids), amino acid metabolism, and carbohydrate metabolism (Figure 4G).

In the BPA group, only 4 differential metabolites were identified, including 3 organic acids (PyrA, fumaric acid, and KIVA) and 1 indole derivative (indole-3-carboxaldehyde) (Figures 4H,I, S6F, and Table S2), which were mostly enriched in the urea cycle, carbohydrate metabolism (citric acid cycle, Warburg effect, etc.), and amino acid metabolism (alanine, aspartate metabolism, etc.) (Figure 4J).

Collectively, these findings demonstrate that T2D progression is mechanistically linked to intestinal metabolic dysregulation, particularly affecting carbohydrate homeostasis, lipid regulation, and amino acid balance. Notably, PS-MPs/BPA coexposure exacerbates the metabolic dysfunction, highlighting the pivotal role of intestinal metabolism in mediating environmental pollutant-induced enteric damage in diabetic conditions.

3.5. Intestinal Metabolic Dysregulation Is Linked to Gut Damage in T2D Mice with PS-MPs Exposure

To further explore the common metabolic variation patterns of T2D and PS-MPs/BPA exposure, differential metabolites in T2D and PS-MPs/BPA were screened out. It has been discovered 5 differential metabolites that exhibited consistent trends in both T2D and PS-MPs groups, including 4 long-chain fatty acids (C14, C15, C16:1, C18:3) and Ado (Figure 5A–F). The correlation analysis revealed a strong relationship between colon length and these metabolites (r > 0.5) (Figure 5G), suggesting the potential link between metabolic changes and PS-MPs-induced intestinal injury. In the BPA group, only KIVA and PyrA exhibited a consistent decreasing trend in the process of BPA exposure (Figure 5H–J). However, KIVA and PyrA showed poor relationship with colon length (r < 0.5) (Figure 5K).

Figure 5. Intestinal metabolic dysregulation is linked to intestinal injury in T2D mice with *PS-MPs* exposure. Intestinal concentration of C14 (A), C15 (B), C16:1 (C), C18:3 (D), and Ado (E) in T2D (n = 10), *PS-MPs* (n ≥ 7), and their corresponding control. (F) Heatmap of differential metabolites in T2D (n = 10) and *PS-MPs* (n ≥ 7). (G) Correlation analysis between FBG, colon length, body weight, and differential metabolites in *PS-MPs*. Intestinal concentration of KIVA (H) and PyrA (I) in T2D (n = 10), BPA (n = 6), and their corresponding control. (J) Heatmap of differential metabolites in T2D (n = 10) and BPA (n = 6). (K) Correlation analysis between FBG, colon length, body weight, and differential metabolites in BPA.

3.6. Altered Metabolites Promote the Expression of Gut Barrier Proteins In Vitro

As many metabolites were altered after exposure to PS-MPs and BPA, we investigated whether these metabolites play a role in protecting the gut barrier. We examined the expression levels of tight junction proteins ZO-1 and occludin in Caco-2 cells treated with C14, C15, C16:1, C18:3, Ado, KIVA, and PyrA for 48 h. C16:1, C18:3, Ado (100 μM; Figure 6A, B), and KIVA (1 μM, 10 μM; Figure 6C–E) significantly increased ZO-1 expression, with a minimal effect on occludin. These findings suggest that C16:1, C18:3, Ado, and KIVA may play a beneficial role in supporting intestinal barrier integrity.

Figure 6. Altered metabolites promote the expression of gut barrier proteins (n = 3). (A) Protein expression level of ZO-1 and occludin with 20 μM (A) and 100 μM (B) C14, C15, C16:1, C18:3, and Ado treatment. Protein expression level of ZO-1 and occludin with 0.1 μM (C), 1 μM (D), and 10 μM (E) KIVA and PyrA treatment. Significance levels are indicated as *p < 0.05 and **p < 0.01.

3.7. Gut Microbiota Dysbiosis Is Closely Correlated to Colonic Metabolic Alterations

To investigate the potential connection between the gut microbiota and intestinal injury, we performed Pearson correlation analyses. In the PS-MPs group, the bacterial genus Duncaniella, which was differentially abundant during exposure, was negatively correlated with colon length (Figure 7A,B). Furthermore, Duncaniella showed a negative correlation with key functional metabolites (C16:1, C18:3, Ado) (Figure 7A,C–E). Conversely, another genus, Olsenella, was positively correlated with colon length, C16:1, C18:3, and Ado levels (Figure 7A,F–I). In the BPA group, the genus Variovorax exhibited a strong correlation with the colon length. However, the correlation between differential genera and functional metabolites (KIVA and PyrA) was relatively weak (Figure 7J). These findings suggest that gut microbiota dysbiosis is closely linked to disrupted colonic metabolism and gut injury, highlighting the regulation of gut microbiota as a promising strategy for preventing intestinal injuries in T2D individuals concurrently exposed to environmental pollutants.

Figure 7. Correlation between gut microbiota dysbiosis and colonic metabolic alterations. (A) Correlation analysis of FBG, colon length, body weight, *Duncaniella, Olsenella*, and differential metabolites in the *PS-MPs* group. (B) Correlation between colon length and *Duncaniella*. (C) Correlation between C16:1 and *Duncaniella*. (D) Correlation between C18:3 and *Duncaniella*. (E) Correlation between Ado and *Duncaniella*. (F) Correlation between colon length and *Olsenella*. (G) Correlation between C16:1 and *Olsenella.* (H) Correlation between C18:3 and *Olsenella*. (I) Correlation between Ado and *Olsenella*. (J) Correlation analysis of FBG, colon length, body weight, *Variovorax, Phocaeicola, Olsenella*, and differential metabolites in BPA. Correlation analyses were performed using Pearson’s method.

4. Discussion

Click to copy section linkSection link copied!

T2D is characterized by hyperglycemia and is often accompanied by complications affecting multiple organs. Over 70% of diabetic patients experience gastrointestinal dysfunctions. (30,31) It is hypothesized that these patients may be more susceptible to environmental exposure, especially those ingested through the gastrointestinal tract. Our study is the first to demonstrate that PS-MPs and BPA can worsen intestinal injury in T2D by disrupting gut microbiota and colonic metabolism. Furthermore, we identified specific metabolites (C16:1, C18:3, Ado, and KIVA) that may have the potential to protect the gut barrier in T2D.

Extensive research has identified gut microbiota dysbiosis as a typical hallmark of T2D, contributing to multiorgan damage through the gut-X axis. While the correlation between microbiota composition and the development of T2D remains debated, a consistent finding is the reduced intestinal flora diversity and increased facultative anaerobic bacteria in T2D individuals. (38) Moreover, disordered gut microbiota exhibit distinct functional properties. Tadashi et al. found that individuals with gut microbiota dominated by Lachnospiraceae exhibit significantly higher insulin resistance indices and elevated fecal monosaccharide concentrations. In contrast, individuals enriched with Bacteroidales are characterized by lower insulin resistance and reduced monosaccharide excretion. (39) In our study, we discovered significant gut microbiota dysbiosis in T2D mice, characterized by reduced α-diversity indices and distinct β-diversity clustering compared with controls, aligning with prior research. Notably, we found a 137-fold increase in Mucispirillum, a spiral-shaped bacterium colonizing the intestinal mucus layer, in the T2D group. Mucispirillum has been implicated in mucin glycoprotein degradation and is associated with gut inflammation, (40) suggesting an imbalance in intestinal homeostasis under T2D pathological conditions and highlighting the potential for gut microbiota intervention in treating gut diseases.

Our results demonstrate that exposure to environmental pollutants, specifically PS-MPs and BPA, exacerbates T2D-associated intestinal injury. This is further evidenced by alterations in the gut microbiota and colonic metabolic profiles. The affected genera were primarily distributed among four phyla: Pseudomonadota, Actinobacteria, Bacteroidota, and Bacillota, which have previously been linked to the degradation of various environmental pollutants, such as N-nitrosamines, (41) organic pollutants (e.g., pesticides and polycyclic aromatic hydrocarbons), and heavy metals. (42) Notably, we identified Duncaniella (Bacteroidota), Olsenella (Actinobacteria), Variovorax (Pseudomonadota), and Phocaeicola (Bacteroidota) as core microbial genera. The abundances of these genera changed in response to both T2D pathology and pollutant exposure. Furthermore, Duncaniella, Olsenella, and Variovorax showed a strong correlation with colon length. Prior study indicates that Duncaniella abundance increases following polylactic acid microplastics exposure, suggesting the role of gut microbiota in environmental contaminant exposure and degradation. (43) Collectively, these findings suggest that targeted gut microbiome interventions may help mitigate pollutant-induced intestinal injury in individuals with T2D.

PS-MPs/BPA exposure disrupts metabolic balance. Existing studies suggest that microplastics induce gut dysbiosis and interfere with the biosynthesis of unsaturated fatty acids, arachidonic acid metabolism, amino metabolism (e.g., arginine biosynthesis, and alanine, aspartate, and glutamate metabolism). (8,44) BPA has been shown to impair tryptophan and 5-hydroxytryptamine metabolism. (45,46) Lipid metabolism disorders are also involved in response to PS-MPs and BPA exposure. (13,17) In our study, we focus on T2D, which is known to be more susceptible to environmental pollutants. Our findings indicated T2D mice exhibited aggravated colonic metabolic disorders, with differential metabolites primarily enriched in fatty acid, amino acid, and carbohydrate metabolism, consistent with previous research. Moreover, we observed that PS-MPs and BPA induced distinct alterations in colonic metabolic profiles among T2D mice. PS-MPs mainly disturbed LCFA metabolism (e.g., C14, C15, C16:1, and C18:3) and adenosine metabolism, while BPA primarily affected energy metabolism. Despite significant changes in gut microbiota composition and colonic metabolic profiles, there were no significant goblet cell reduction or mucosal damage in the colons of T2D mice, suggesting that microbial and metabolic changes may serve as more sensitive indicators than histological alterations for early detection.

Bioactive metabolites demonstrated significant therapeutic potential for disease intervention. For example, Chen et al. showed that C16:1 ameliorates colon inflammation in DSS-induced acute colitis in mice and enhances therapeutic effects when combined with anti-TNF-α antibodies. (47) C18:3 also mitigates T. gondii-associated colitis through microbiota modulation and inflammatory suppression. (48) Adenosine signaling plays a key role in modulating inflammatory responses and promoting epithelial barrier restoration. Pharmacological targeting of adenosine receptors (A2A/A2B) represents a promising therapeutic strategy for colitis. (49) In our study, we identified four bioactive metabolites (C16:1, C18:3, Ado, and KIVA), which significantly increased the expression of the tight junction protein ZO-1, highlighting their potential for barrier protection. Furthermore, correlation analysis revealed that metabolites such as C14, C15, C16:1, and C18:3 are positively associated with colon length, suggesting that metabolic regulation could be a valuable strategy for restoring barrier function and promoting intestinal health.

This study has several limitations. First, the PS-MPs utilized were characterized by a uniform particle size and single composition, which does not adequately simulate the complex pollution environments found in real life. Moreover, while our research demonstrated that exposure to environmental contaminants (PS-MPs/BPA) exacerbates gut injury in T2D mice, validation in humans is still required. Additionally, further research is needed to explore the function of bacteria identified in PS-MPs/BPA-induced gut injury. Despite these limitations, our findings offer valuable insights into the impact of environmental pollutants on intestinal injury in T2D.

5. Conclusions

Click to copy section linkSection link copied!

This is the first study to demonstrate that exposure to environmental contaminants (PS-MPs/BPA) significantly contributes to the progression of intestinal injury in T2D. The detrimental effect of PS-MPs/BPA on gut barrier integrity in T2D is attributed to disrupted gut microbiota and colonic metabolism. These findings could inform strategies for reducing exposure to PS-MPs/BPA in patients with T2D to mitigate the risk of a severe intestinal injury.

Supporting Information

Click to copy section linkSection link copied!

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acs.chemrestox.5c00359.

Figure S1. Colonic inflammatory factors expression in T2D mice. Figure S2. Organ coefficient and FBG in T2D mice with PS-MPs/BPA exposure. Figure S3. Colonic inflammatory factors expression in T2D mice with PS-MPs/BPA exposure. Figure S4. Colonic protein expression in T2D mice with PS-MPs/BPA exposure. Figure S5. Linear discriminant analysis effect size (LEfSe) comparing the Control and T2D groups. Figure S6. Metabolomics analysis in T2D mice with PS-MPs/BPA exposure. Table S1. Metabolite retention time and MRM parameters. Table S2. Intestinal differential metabolites between groups (PDF)

tx5c00359_si_001.pdf (1.04 MB)

Terms & Conditions

Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.

Author Information

Click to copy section linkSection link copied!

Corresponding Authors
- Fengguo Xu - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China; https://orcid.org/0000-0001-9999-0128; Email: [email protected]
- Pei Zhang - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; Affiliated Jiangning Chinese Medicine Hospital, China Pharmaceutical University, Nanjing 211100, P. R. China; Nanjing Jiangning Hospital of Chinese Medicine, Nanjing 211100, P. R. China; Email: [email protected]
Authors
- Ying Zhang - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
- Qiyao Nong - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
- Yuanyuan Zhang - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
- Fanfei Meng - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
- Xinyuan Hao - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
- Yuan Tian - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China
- Zunjian Zhang - Key Laboratory of Drug Quality Control and Pharmacovigilance (Ministry of Education), Nanjing 210009, P. R. China; State Key Laboratory of Natural Medicines, China Pharmaceutical University, Nanjing 210009, P. R. China
Author Contributions
CRediT: Ying Zhang formal analysis, investigation, methodology, validation, visualization, writing - original draft; Qiyao Nong data curation, investigation, methodology; Yuanyuan Zhang data curation, investigation; Fanfei Meng investigation; Xinyuan Hao investigation; Yuan Tian resources; Zunjian Zhang project administration, resources; Fengguo Xu conceptualization, funding acquisition, project administration, supervision, writing - review & editing; Pei Zhang conceptualization, funding acquisition, project administration, supervision, writing - review & editing.
Funding
This study was supported by NSFC (nos. 82473883, 82273896, and U24A20788), the Fundamental Research Funds for the Central Universities (no. 2632024ZD02), and Project Program of State Key Laboratory of Natural Medicines, China Pharmaceutical University (no. SKLNMZZ2024JS21).
Notes
The authors declare no competing financial interest.

Acknowledgments

Click to copy section linkSection link copied!

The authors would like to thank Qiang Wang, Meiyu Gao, and Qinwen Xiao from China Pharmaceutical University (Nanjing, China) for their help with data analysis, instrumental operation, and sample collection.

Abbreviations

Click to copy section linkSection link copied!

T2D	type 2 diabetes
LCFAs	long-chain fatty acids
KIVA	α-ketoisovaleric acid
PyrA	pyruvic acid
C16:1	palmitoleic acid
MPs	microplastics
BPA	bisphenol A
PS-MPs	polystyrene microplastics
ACN	acetonitrile
MeOH	methanol
C14	myristic acid
C15	pentadecanoic acid
C18:3	γ-linolenic acid
Ado	adenosine
SPF	specific pathogen free
FBG	fast blood glucose
PVDF	polyvinylidene difluoride
HRP	horseradish peroxidase
ECL	enhanced chemiluminescence
OTUs	operational taxonomic units
H&E	hematoxylin and eosin
PAS	periodic acid-schiff stain
FTIR	Fourier-transform infrared spectroscopy
SEM	scanning electron microscopy
DLC	dynamic light scattering
PS	polystyrene
PDI	polydispersion index

References

Click to copy section linkSection link copied!

This article references 49 other publications.

1
Carpenter, E. J.; Smith, K. L., Jr Plastics on the Sargasso sea surface. Science 1972, 175 (4027), 1240– 1241, DOI: 10.1126/science.175.4027.1240
Google Scholar
There is no corresponding record for this reference.
2
Wright, S. L.; Ulke, J.; Font, A.; Chan, K. L. A.; Kelly, F. J. Atmospheric microplastic deposition in an urban environment and an evaluation of transport. Environ. Int. 2020, 136, 105411 DOI: 10.1016/j.envint.2019.105411
Google Scholar
There is no corresponding record for this reference.
3
Golwala, H.; Zhang, X.; Iskander, S. M.; Smith, A. L. Solid waste: An overlooked source of microplastics to the environment. Sci. Total Environ. 2021, 769, 144581 DOI: 10.1016/j.scitotenv.2020.144581
Google Scholar
There is no corresponding record for this reference.
4
Thompson, R. C.; Courtene-Jones, W.; Boucher, J.; Pahl, S.; Raubenheimer, K.; Koelmans, A. A. Twenty years of microplastic pollution research-what have we learned?. Science 2024, 386 (6720), eadl2746 DOI: 10.1126/science.adl2746
Google Scholar
There is no corresponding record for this reference.
5
Hernandez, L. M.; Xu, E. G.; Larsson, H. C. E.; Tahara, R.; Maisuria, V. B.; Tufenkji, N. Plastic Teabags Release Billions of Microparticles and Nanoparticles into Tea. Environ. Sci. Technol. 2019, 53 (21), 12300– 12310, DOI: 10.1021/acs.est.9b02540
Google Scholar
There is no corresponding record for this reference.
6
Hussain, K. A.; Romanova, S.; Okur, I.; Zhang, D.; Kuebler, J.; Huang, X.; Wang, B.; Fernandez-Ballester, L.; Lu, Y.; Schubert, M.; Li, Y. Assessing the Release of Microplastics and Nanoplastics from Plastic Containers and Reusable Food Pouches: Implications for Human Health. Environ. Sci. Technol. 2023, 57 (26), 9782– 9792, DOI: 10.1021/acs.est.3c01942
Google Scholar
There is no corresponding record for this reference.
7
Wu, P.; Fan, Y.; Zhang, X.; Wu, W.; Zhang, Z.; Wu, Y.; Wang, J.; Xu, J.; Chen, T.; Gao, B. Seasonal dynamics, tidal influences, and anthropogenic impacts on microplastic distribution in the Yangtze River estuary: A comprehensive characterization and comparative analysis. J. Hazard Mater. 2024, 476, 135167 DOI: 10.1016/j.jhazmat.2024.135167
Google Scholar
There is no corresponding record for this reference.
8
Zhang, Z.; Chen, W.; Chan, H.; Peng, J.; Zhu, P.; Li, J.; Jiang, X.; Zhang, Z.; Wang, Y.; Tan, Z.; Peng, Y.; Zhang, S.; Lin, K.; Yung, K. K. Polystyrene microplastics induce size-dependent multi-organ damage in mice: Insights into gut microbiota and fecal metabolites. J. Hazard Mater. 2024, 461, 132503 DOI: 10.1016/j.jhazmat.2023.132503
Google Scholar
There is no corresponding record for this reference.
9
Wang, Y. L.; Lee, Y. H.; Hsu, Y. H.; Chiu, I. J.; Huang, C. C.; Huang, C. C.; Chia, Z. C.; Lee, C. P.; Lin, Y. F.; Chiu, H. W. The Kidney-Related Effects of Polystyrene Microplastics on Human Kidney Proximal Tubular Epithelial Cells HK-2 and Male C57BL/6 Mice. Environ. Health Perspect. 2021, 129 (5), 57003, DOI: 10.1289/EHP7612
Google Scholar
There is no corresponding record for this reference.
10
Geens, T.; Aerts, D.; Berthot, C.; Bourguignon, J. P.; Goeyens, L.; Lecomte, P.; Maghuin-Rogister, G.; Pironnet, A. M.; Pussemier, L.; Scippo, M. L.; Van Loco, J.; Covaci, A. A review of dietary and non-dietary exposure to bisphenol-A. Food Chem. Toxicol. 2012, 50 (10), 3725– 3740, DOI: 10.1016/j.fct.2012.07.059
Google Scholar
There is no corresponding record for this reference.
11
Lind, T.; Dunder, L.; Lejonklou, M. H.; Lind, P. M.; Melhus, H.; Lind, L. Developmental low-dose bisphenol A exposure leads to extensive transcriptome female masculinization and male feminization later in life. Commun. Med. (Lond) 2025, 5 (1), 410, DOI: 10.1038/s43856-025-01119-8
Google Scholar
There is no corresponding record for this reference.
12
Wang, R.; Liu, Z. H.; Bi, N.; Gu, X.; Huang, C.; Zhou, R.; Liu, H.; Wang, H. L. Dysfunction of the medial prefrontal cortex contributes to BPA-induced depression- and anxiety-like behavior in mice. Ecotoxicol Environ. Saf 2023, 259, 115034 DOI: 10.1016/j.ecoenv.2023.115034
Google Scholar
There is no corresponding record for this reference.
13
He, W.; Gao, Z.; Liu, S.; Tan, L.; Wu, Y.; Liu, J.; Zheng, Z.; Fan, W.; Luo, Y.; Chen, Z.; Song, S. G protein-coupled estrogen receptor activation by bisphenol-A disrupts lipid metabolism and induces ferroptosis in the liver. Environ. Pollut. 2023, 334, 122211 DOI: 10.1016/j.envpol.2023.122211
Google Scholar
There is no corresponding record for this reference.
14
Lee, I.; Park, Y. J.; Kim, M. J.; Kim, S.; Choi, S.; Park, J.; Cho, Y. H.; Hong, S.; Yoo, J.; Park, H.; Cheon, G. J.; Choi, K.; Moon, M. K. Associations of urinary concentrations of phthalate metabolites, bisphenol A, and parabens with obesity and diabetes mellitus in a Korean adult population: Korean National Environmental Health Survey (KoNEHS) 2015–2017. Environ. Int. 2021, 146, 106227 DOI: 10.1016/j.envint.2020.106227
Google Scholar
There is no corresponding record for this reference.
15
Geens, T.; Neels, H.; Covaci, A. Distribution of bisphenol-A, triclosan and n-nonylphenol in human adipose tissue, liver and brain. Chemosphere 2012, 87 (7), 796– 802, DOI: 10.1016/j.chemosphere.2012.01.002
Google Scholar
There is no corresponding record for this reference.
16
Soundararajan, A.; Prabu, P.; Mohan, V.; Gibert, Y.; Balasubramanyam, M. Novel insights of elevated systemic levels of bisphenol-A (BPA) linked to poor glycemic control, accelerated cellular senescence and insulin resistance in patients with type 2 diabetes. Mol. Cell. Biochem. 2019, 458 (1–2), 171– 183, DOI: 10.1007/s11010-019-03540-9
Google Scholar
There is no corresponding record for this reference.
17
Chiu, H. W.; Chu, C. W.; Huang, C. C.; Chia, Z. C.; Wang, Y. L.; Lee, Y. H. Polystyrene microplastics induce hepatic lipid metabolism and energy disorder by upregulating the NR4A1-AMPK signaling pathway. Environ. Pollut. 2025, 369, 125850 DOI: 10.1016/j.envpol.2025.125850
Google Scholar
There is no corresponding record for this reference.
18
Wang, W.; Guan, J.; Feng, Y.; Nie, L.; Xu, Y.; Xu, H.; Fu, F. Polystyrene microplastics induced nephrotoxicity associated with oxidative stress, inflammation, and endoplasmic reticulum stress in juvenile rats. Front. Nutr. 2022, 9, 1059660 DOI: 10.3389/fnut.2022.1059660
Google Scholar
There is no corresponding record for this reference.
19
Li, B.; Ding, Y.; Cheng, X.; Sheng, D.; Xu, Z.; Rong, Q.; Wu, Y.; Zhao, H.; Ji, X.; Zhang, Y. Polyethylene microplastics affect the distribution of gut microbiota and inflammation development in mice. Chemosphere 2020, 244, 125492 DOI: 10.1016/j.chemosphere.2019.125492
Google Scholar
There is no corresponding record for this reference.
20
Sun, H.; Chen, N.; Yang, X.; Xia, Y.; Wu, D. Effects induced by polyethylene microplastics oral exposure on colon mucin release, inflammation, gut microflora composition and metabolism in mice. Ecotoxicol Environ. Saf 2021, 220, 112340 DOI: 10.1016/j.ecoenv.2021.112340
Google Scholar
There is no corresponding record for this reference.
21
Jing, J.; Zhang, L.; Han, L.; Wang, J.; Zhang, W.; Liu, Z.; Gao, A. Polystyrene micro-/nanoplastics induced hematopoietic damages via the crosstalk of gut microbiota, metabolites, and cytokines. Environ. Int. 2022, 161, 107131 DOI: 10.1016/j.envint.2022.107131
Google Scholar
There is no corresponding record for this reference.
22
Zhao, Q. L.; Yang, F.; Pu, Q. Y.; Zhao, R.; Jiang, S.; Tang, Y. P. Integrative metabolomics and gut microbiota analyses reveal the protective effects of DHA-enriched phosphatidylserine on bisphenol A-induced intestinal damage. J. Funct. Foods 2024, 117, 106229 DOI: 10.1016/j.jff.2024.106229
Google Scholar
There is no corresponding record for this reference.
23
Feng, L.; Chen, S.; Zhang, L.; Qu, W.; Chen, Z. Bisphenol A increases intestinal permeability through disrupting intestinal barrier function in mice. Environ. Pollut. 2019, 254 (Pt A), 112960 DOI: 10.1016/j.envpol.2019.112960
Google Scholar
There is no corresponding record for this reference.
24
Feng, D.; Zhang, H.; Jiang, X.; Zou, J.; Li, Q.; Mai, H.; Su, D.; Ling, W.; Feng, X. Bisphenol A exposure induces gut microbiota dysbiosis and consequent activation of gut-liver axis leading to hepatic steatosis in CD-1 mice. Environ. Pollut. 2020, 265 (Pt A), 114880 DOI: 10.1016/j.envpol.2020.114880
Google Scholar
There is no corresponding record for this reference.
25
Pelaseyed, T.; Bergstrom, J. H.; Gustafsson, J. K.; Ermund, A.; Birchenough, G. M.; Schutte, A.; van der Post, S.; Svensson, F.; Rodriguez-Pineiro, A. M.; Nystrom, E. E.; Wising, C.; Johansson, M. E.; Hansson, G. C. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunol Rev. 2014, 260 (1), 8– 20, DOI: 10.1111/imr.12182
Google Scholar
There is no corresponding record for this reference.
26
James, K. R.; Gomes, T.; Elmentaite, R.; Kumar, N.; Gulliver, E. L.; King, H. W.; Stares, M. D.; Bareham, B. R.; Ferdinand, J. R.; Petrova, V. N.; Polanski, K.; Forster, S. C.; Jarvis, L. B.; Suchanek, O.; Howlett, S.; James, L. K.; Jones, J. L.; Meyer, K. B.; Clatworthy, M. R.; Saeb-Parsy, K.; Lawley, T. D.; Teichmann, S. A. Distinct microbial and immune niches of the human colon. Nat. Immunol 2020, 21 (3), 343– 353, DOI: 10.1038/s41590-020-0602-z
Google Scholar
There is no corresponding record for this reference.
27
Wang, L.; Chen, J.; Zhang, X.; Xu, M.; Zhang, X.; Zhao, W.; Cui, J. Effects of microplastics and tetracycline on intestinal injury in mice. Chemosphere 2023, 337, 139364 DOI: 10.1016/j.chemosphere.2023.139364
Google Scholar
There is no corresponding record for this reference.
28
Ahmad, E.; Lim, S.; Lamptey, R.; Webb, D. R.; Davies, M. J. Type 2 diabetes. Lancet 2022, 400 (10365), 1803– 1820, DOI: 10.1016/S0140-6736(22)01655-5
Google Scholar
There is no corresponding record for this reference.
29
Saeedi, P.; Petersohn, I.; Salpea, P.; Malanda, B.; Karuranga, S.; Unwin, N.; Colagiuri, S.; Guariguata, L.; Motala, A. A.; Ogurtsova, K.; Shaw, J. E.; Bright, D.; Williams, R.; IDF Diabetes Atlas Committee Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9^th edition. Diabetes Res. Clin. Pract. 2019, 157, 107843 DOI: 10.1016/j.diabres.2019.107843
Google Scholar
There is no corresponding record for this reference.
30
Asgharnezhad, M.; Joukar, F.; Fathalipour, M.; Khosousi, M.; Hassanipour, S.; Pourshams, A.; Mansour-Ghanaei, R.; Mansour-Ghanaei, F. Gastrointestinal symptoms in patients with diabetes mellitus and non-diabetic: A cross-sectional study in north of Iran. Diabetes Metab Syndr 2019, 13 (3), 2236– 2240, DOI: 10.1016/j.dsx.2019.05.028
Google Scholar
There is no corresponding record for this reference.
31
Kim, J. H.; Park, H. S.; Ko, S. Y.; Hong, S. N.; Sung, I. K.; Shim, C. S.; Song, K. H.; Kim, D. L.; Kim, S. K.; Oh, J. Diabetic factors associated with gastrointestinal symptoms in patients with type 2 diabetes. World J. Gastroenterol 2010, 16 (14), 1782– 1787, DOI: 10.3748/wjg.v16.i14.1782
Google Scholar
There is no corresponding record for this reference.
32
Abdalla, M. M. I. Enteric neuropathy in diabetes: Implications for gastrointestinal function. World J. Gastroenterol 2024, 30 (22), 2852– 2865, DOI: 10.3748/wjg.v30.i22.2852
Google Scholar
There is no corresponding record for this reference.
33
Ma, J. W.; Lai, T. J.; Hu, S. Y.; Lin, T. C.; Ho, W. C.; Tsan, Y. T. Effect of ambient air pollution on the incidence of colorectal cancer among a diabetic population: a nationwide nested case-control study in Taiwan. BMJ. Open 2020, 10 (10), e036955 DOI: 10.1136/bmjopen-2020-036955
Google Scholar
There is no corresponding record for this reference.
34
Zitouni, N.; Bousserrhine, N.; Belbekhouche, S.; Missawi, O.; Alphonse, V.; Boughatass, I.; Banni, M. First report on the presence of small microplastics (≤3 μm) in tissue of the commercial fish Serranus scriba (Linnaeus. 1758) from Tunisian coasts and associated cellular alterations. Environ. Pollut. 2020, 263 (Pt A), 114576 DOI: 10.1016/j.envpol.2020.114576
Google Scholar
There is no corresponding record for this reference.
35
Senathirajah, K.; Attwood, S.; Bhagwat, G.; Carbery, M.; Wilson, S.; Palanisami, T. Estimation of the mass of microplastics ingested - A pivotal first step towards human health risk assessment. J. Hazard. Mater. 2021, 404 (Pt B), 124004 DOI: 10.1016/j.jhazmat.2020.124004
Google Scholar
There is no corresponding record for this reference.
36
Cox, K. D.; Covernton, G. A.; Davies, H. L.; Dower, J. F.; Juanes, F.; Dudas, S. E. Human Consumption of Microplastics. Environ. Sci. Technol. 2019, 53 (12), 7068– 7074, DOI: 10.1021/acs.est.9b01517
Google Scholar
There is no corresponding record for this reference.
37
Qin, S.; Gao, M.; Zhang, Q.; Xiao, Q.; Fu, J.; Tian, Y.; Jiao, Y.; Zhang, Z.; Zhang, P.; Xu, F. High-Coverage Strategy for Multi-Subcellular Metabolome Analysis Using Dansyl-Labeling-Based LC-MS/MS. Anal. Chem. 2023, 95 (26), 10034– 10043, DOI: 10.1021/acs.analchem.3c01343
Google Scholar
There is no corresponding record for this reference.
38
Baars, D. P.; Fondevila, M. F.; Meijnikman, A. S.; Nieuwdorp, M. The central role of the gut microbiota in the pathophysiology and management of type 2 diabetes. Cell Host Microbe 2024, 32 (8), 1280– 1300, DOI: 10.1016/j.chom.2024.07.017
Google Scholar
There is no corresponding record for this reference.
39
Takeuchi, T.; Kubota, T.; Nakanishi, Y.; Tsugawa, H.; Suda, W.; Kwon, A. T.; Yazaki, J.; Ikeda, K.; Nemoto, S.; Mochizuki, Y.; Kitami, T.; Yugi, K.; Mizuno, Y.; Yamamichi, N.; Yamazaki, T.; Takamoto, I.; Kubota, N.; Kadowaki, T.; Arner, E.; Carninci, P.; Ohara, O.; Arita, M.; Hattori, M.; Koyasu, S.; Ohno, H. Gut microbial carbohydrate metabolism contributes to insulin resistance. Nature 2023, 621 (7978), 389– 395, DOI: 10.1038/s41586-023-06466-x
Google Scholar
There is no corresponding record for this reference.
40
Herp, S.; Durai Raj, A. C.; Salvado Silva, M.; Woelfel, S.; Stecher, B. The human symbiont Mucispirillum schaedleri: causality in health and disease. Med. Microbiol Immunol 2021, 210 (4), 173– 179, DOI: 10.1007/s00430-021-00702-9
Google Scholar
There is no corresponding record for this reference.
41
Liu, J.; Zhao, B.; Wang, L.; Zhang, W.; Zan, T.; Chen, Z.; Li, Y. Occurrence, fate, and transport of N-nitrosamines and precursors in sewage treatment plants and receiving rivers in a highly urbanized basin. Environ. Pollut. 2025, 368, 125808 DOI: 10.1016/j.envpol.2025.125808
Google Scholar
There is no corresponding record for this reference.
42
Behera, S.; Das, S. Potential and prospects of Actinobacteria in the bioremediation of environmental pollutants: Cellular mechanisms and genetic regulations. Microbiol Res. 2023, 273, 127399 DOI: 10.1016/j.micres.2023.127399
Google Scholar
There is no corresponding record for this reference.
43
Bao, L.; Cui, X.; Zeng, T.; Liu, G.; Lai, W.; Zhao, H.; Gao, F.; Wu, J.; Leong, K. W.; Chen, C. Incorporation of polylactic acid microplastics into the carbon cycle as a carbon source to remodel the endogenous metabolism of the gut. Proc. Natl. Acad. Sci. U. S. A. 2025, 122 (19), e2417104122 DOI: 10.1073/pnas.2417104122
Google Scholar
There is no corresponding record for this reference.
44
Zhang, K.; Yang, J.; Chen, L.; He, J.; Qu, D.; Zhang, Z.; Liu, Y.; Li, X.; Liu, J.; Li, J.; Xie, X.; Wang, Q. Gut Microbiota Participates in Polystyrene Microplastics-Induced Hepatic Injuries by Modulating the Gut-Liver Axis. ACS Nano 2023, 17 (15), 15125– 15145, DOI: 10.1021/acsnano.3c04449
Google Scholar
There is no corresponding record for this reference.
45
Ni, Y.; Hu, L.; Yang, S.; Ni, L.; Ma, L.; Zhao, Y.; Zheng, A.; Jin, Y.; Fu, Z. Bisphenol A impairs cognitive function and 5-HT metabolism in adult male mice by modulating the microbiota-gut-brain axis. Chemosphere 2021, 282, 130952 DOI: 10.1016/j.chemosphere.2021.130952
Google Scholar
There is no corresponding record for this reference.
46
DeLuca, J. A.; Allred, K. F.; Menon, R.; Riordan, R.; Weeks, B. R.; Jayaraman, A.; Allred, C. D. Bisphenol-A alters microbiota metabolites derived from aromatic amino acids and worsens disease activity during colitis. Exp Biol. Med. (Maywood) 2018, 243 (10), 864– 875, DOI: 10.1177/1535370218782139
Google Scholar
There is no corresponding record for this reference.
47
Chen, Y.; Mai, Q.; Chen, Z.; Lin, T.; Cai, Y.; Han, J.; Wang, Y.; Zhang, M.; Tan, S.; Wu, Z.; Chen, L.; Zhang, Z.; Yang, Y.; Cui, T.; Ouyang, B.; Sun, Y.; Yang, L.; Xu, L.; Zhang, S.; Li, J.; Shen, H.; Liu, L.; Zeng, L.; Zhang, S.; Zeng, G. Dietary palmitoleic acid reprograms gut microbiota and improves biological therapy against colitis. Gut Microbes 2023, 15 (1), 2211501 DOI: 10.1080/19490976.2023.2211501
Google Scholar
There is no corresponding record for this reference.
48
Yang, J.; Liu, S.; Zhao, Q.; Li, X.; Jiang, K. Gut microbiota-related metabolite alpha-linolenic acid mitigates intestinal inflammation induced by oral infection with Toxoplasma gondii. Microbiome 2023, 11 (1), 273, DOI: 10.1186/s40168-023-01681-0
Google Scholar
There is no corresponding record for this reference.
49
Bahreyni, A.; Samani, S. S.; Khazaei, M.; Ryzhikov, M.; Avan, A.; Hassanian, S. M. Therapeutic potentials of adenosine receptors agonists and antagonists in colitis; Current status and perspectives. J. Cell Physiol 2018, 233 (4), 2733– 2740, DOI: 10.1002/jcp.26073
Google Scholar
There is no corresponding record for this reference.

Cited By

Click to copy section linkSection link copied!

This article is cited by 1 publications.

Liangliang Dai, Chenjie Qiu, . Integrated Multiomics Elucidates Molecular Mechanisms of Bisphenol A in Exacerbating Crohn’s Disease. Mediators of Inflammation 2026, 2026 (1) https://doi.org/10.1155/mi/2903373

Get e-Alerts

Chemical Research in Toxicology

Cite this: Chem. Res. Toxicol. 2026, 39, 1, 104–116

Click to copy citationCitation copied!

https://doi.org/10.1021/acs.chemrestox.5c00359

Published December 28, 2025

Request reuse permissions

Article Views

Altmetric

Citations

Learn about these metrics

Article Views are the COUNTER-compliant sum of full text article downloads since November 2008 (both PDF and HTML) across all institutions and individuals. These metrics are regularly updated to reflect usage leading up to the last few days.

Citations are the number of other articles citing this article, calculated by Crossref and updated daily. Find more information about Crossref citation counts.

The Altmetric Attention Score is a quantitative measure of the attention that a research article has received online. Clicking on the donut icon will load a page at altmetric.com with additional details about the score and the social media presence for the given article. Find more information on the Altmetric Attention Score and how the score is calculated.

Abstract
High Resolution Image
Download MS PowerPoint Slide
Figure 1
Figure 1. T2D mice exhibit mild gut injury. (A) FBG levels and (B) colon length in T2D and control groups (n = 10). (C) Correlation analysis between FBG and colon length. (D) Correlation analysis among FBG, colon length, body weight, and organ coefficients. (E) Protein expression levels of ZO-1 and occludin in the colon (n = 6). (F) Representative images of H&E and PAS staining of colon tissues (n = 3) (100×). Significance levels are indicated as ns (not significant), **p < 0.01, ****p < 0.0001.
High Resolution Image
Download MS PowerPoint Slide
Figure 2
Figure 2. PS-MPs and BPA exposures promote intestinal injury in T2D mice. (A) PS-MPs confirmation by Fourier-transform infrared spectroscopy. (B) Scanning electron microscopy of PS-MPs. (C) Zeta potentials of the PS-MPs. Colon length of (D) PS-MPs (n ≥ 7) and (E) BPA group (n = 6). (F) Representative images of H&E and PAS staining of colon tissues (n = 3) (100×, yellow arrows indicate reduced goblet cells and mucus secretion). Intestinal ZO-1 and occludin expression of (G) PS-MPs and (H) BPA group (n = 6). Significance levels are indicated as ns (not significant), *p < 0.05, **p < 0.01, and ****p < 0.0001.
High Resolution Image
Download MS PowerPoint Slide
Figure 3
Figure 3. PS-MPs and BPA exposures alter gut microbiota in T2D mice (n = 3). (A–C) Alpha diversity indices of the T2D, PS-MPs, and BPA groups. (D–F) PCoA analysis of the T2D, PS-MPs, and BPA groups. Linear discriminant analysis effective size (LEfSe) identifying differentially abundant taxa at the genus level between (G) PS-MPs-C and PS-MPs, and (H) BPA-C and BPA groups. Significance determined with a linear discriminant analysis (LDA) score (log 10) > 2. **p < 0.01.
High Resolution Image
Download MS PowerPoint Slide
Figure 4
Figure 4. PS-MPs and BPA exposures induce gut metabolic dysregulations in T2D mice. (A) PCA analysis based on LC-MS metabolomics data. (B, E, H) Pie chart showing the categories of differential metabolites in the T2D (n = 10), PS-MPs (n ≥ 7), and BPA (n = 6) groups, respectively. (C, F, I) Volcano plots illustrating differential metabolites in the T2D (n = 10), PS-MPs (n ≥ 7), and BPA (n = 6) groups, respectively. (D, G, J) Pathway enrichment analysis of differential metabolites in the T2D (n = 10), PS-MPs (n ≥ 7), and BPA (n = 6) groups, respectively.
High Resolution Image
Download MS PowerPoint Slide
Figure 5
Figure 5. Intestinal metabolic dysregulation is linked to intestinal injury in T2D mice with PS-MPs exposure. Intestinal concentration of C14 (A), C15 (B), C16:1 (C), C18:3 (D), and Ado (E) in T2D (n = 10), PS-MPs (n ≥ 7), and their corresponding control. (F) Heatmap of differential metabolites in T2D (n = 10) and PS-MPs (n ≥ 7). (G) Correlation analysis between FBG, colon length, body weight, and differential metabolites in PS-MPs. Intestinal concentration of KIVA (H) and PyrA (I) in T2D (n = 10), BPA (n = 6), and their corresponding control. (J) Heatmap of differential metabolites in T2D (n = 10) and BPA (n = 6). (K) Correlation analysis between FBG, colon length, body weight, and differential metabolites in BPA.
High Resolution Image
Download MS PowerPoint Slide
Figure 6
Figure 6. Altered metabolites promote the expression of gut barrier proteins (n = 3). (A) Protein expression level of ZO-1 and occludin with 20 μM (A) and 100 μM (B) C14, C15, C16:1, C18:3, and Ado treatment. Protein expression level of ZO-1 and occludin with 0.1 μM (C), 1 μM (D), and 10 μM (E) KIVA and PyrA treatment. Significance levels are indicated as *p < 0.05 and **p < 0.01.
High Resolution Image
Download MS PowerPoint Slide
Figure 7
Figure 7. Correlation between gut microbiota dysbiosis and colonic metabolic alterations. (A) Correlation analysis of FBG, colon length, body weight, Duncaniella, Olsenella, and differential metabolites in the PS-MPs group. (B) Correlation between colon length and Duncaniella. (C) Correlation between C16:1 and Duncaniella. (D) Correlation between C18:3 and Duncaniella. (E) Correlation between Ado and Duncaniella. (F) Correlation between colon length and Olsenella. (G) Correlation between C16:1 and Olsenella. (H) Correlation between C18:3 and Olsenella. (I) Correlation between Ado and Olsenella. (J) Correlation analysis of FBG, colon length, body weight, Variovorax, Phocaeicola, Olsenella, and differential metabolites in BPA. Correlation analyses were performed using Pearson’s method.
High Resolution Image
Download MS PowerPoint Slide
References
This article references 49 other publications.
1. 1
  Carpenter, E. J.; Smith, K. L., Jr Plastics on the Sargasso sea surface. Science 1972, 175 (4027), 1240– 1241, DOI: 10.1126/science.175.4027.1240
  There is no corresponding record for this reference.
2. 2
  Wright, S. L.; Ulke, J.; Font, A.; Chan, K. L. A.; Kelly, F. J. Atmospheric microplastic deposition in an urban environment and an evaluation of transport. Environ. Int. 2020, 136, 105411 DOI: 10.1016/j.envint.2019.105411
  There is no corresponding record for this reference.
3. 3
  Golwala, H.; Zhang, X.; Iskander, S. M.; Smith, A. L. Solid waste: An overlooked source of microplastics to the environment. Sci. Total Environ. 2021, 769, 144581 DOI: 10.1016/j.scitotenv.2020.144581
  There is no corresponding record for this reference.
4. 4
  Thompson, R. C.; Courtene-Jones, W.; Boucher, J.; Pahl, S.; Raubenheimer, K.; Koelmans, A. A. Twenty years of microplastic pollution research-what have we learned?. Science 2024, 386 (6720), eadl2746 DOI: 10.1126/science.adl2746
  There is no corresponding record for this reference.
5. 5
  Hernandez, L. M.; Xu, E. G.; Larsson, H. C. E.; Tahara, R.; Maisuria, V. B.; Tufenkji, N. Plastic Teabags Release Billions of Microparticles and Nanoparticles into Tea. Environ. Sci. Technol. 2019, 53 (21), 12300– 12310, DOI: 10.1021/acs.est.9b02540
  There is no corresponding record for this reference.
6. 6
  Hussain, K. A.; Romanova, S.; Okur, I.; Zhang, D.; Kuebler, J.; Huang, X.; Wang, B.; Fernandez-Ballester, L.; Lu, Y.; Schubert, M.; Li, Y. Assessing the Release of Microplastics and Nanoplastics from Plastic Containers and Reusable Food Pouches: Implications for Human Health. Environ. Sci. Technol. 2023, 57 (26), 9782– 9792, DOI: 10.1021/acs.est.3c01942
  There is no corresponding record for this reference.
7. 7
  Wu, P.; Fan, Y.; Zhang, X.; Wu, W.; Zhang, Z.; Wu, Y.; Wang, J.; Xu, J.; Chen, T.; Gao, B. Seasonal dynamics, tidal influences, and anthropogenic impacts on microplastic distribution in the Yangtze River estuary: A comprehensive characterization and comparative analysis. J. Hazard Mater. 2024, 476, 135167 DOI: 10.1016/j.jhazmat.2024.135167
  There is no corresponding record for this reference.
8. 8
  Zhang, Z.; Chen, W.; Chan, H.; Peng, J.; Zhu, P.; Li, J.; Jiang, X.; Zhang, Z.; Wang, Y.; Tan, Z.; Peng, Y.; Zhang, S.; Lin, K.; Yung, K. K. Polystyrene microplastics induce size-dependent multi-organ damage in mice: Insights into gut microbiota and fecal metabolites. J. Hazard Mater. 2024, 461, 132503 DOI: 10.1016/j.jhazmat.2023.132503
  There is no corresponding record for this reference.
9. 9
  Wang, Y. L.; Lee, Y. H.; Hsu, Y. H.; Chiu, I. J.; Huang, C. C.; Huang, C. C.; Chia, Z. C.; Lee, C. P.; Lin, Y. F.; Chiu, H. W. The Kidney-Related Effects of Polystyrene Microplastics on Human Kidney Proximal Tubular Epithelial Cells HK-2 and Male C57BL/6 Mice. Environ. Health Perspect. 2021, 129 (5), 57003, DOI: 10.1289/EHP7612
  There is no corresponding record for this reference.
10. 10
  Geens, T.; Aerts, D.; Berthot, C.; Bourguignon, J. P.; Goeyens, L.; Lecomte, P.; Maghuin-Rogister, G.; Pironnet, A. M.; Pussemier, L.; Scippo, M. L.; Van Loco, J.; Covaci, A. A review of dietary and non-dietary exposure to bisphenol-A. Food Chem. Toxicol. 2012, 50 (10), 3725– 3740, DOI: 10.1016/j.fct.2012.07.059
  There is no corresponding record for this reference.
11. 11
  Lind, T.; Dunder, L.; Lejonklou, M. H.; Lind, P. M.; Melhus, H.; Lind, L. Developmental low-dose bisphenol A exposure leads to extensive transcriptome female masculinization and male feminization later in life. Commun. Med. (Lond) 2025, 5 (1), 410, DOI: 10.1038/s43856-025-01119-8
  There is no corresponding record for this reference.
12. 12
  Wang, R.; Liu, Z. H.; Bi, N.; Gu, X.; Huang, C.; Zhou, R.; Liu, H.; Wang, H. L. Dysfunction of the medial prefrontal cortex contributes to BPA-induced depression- and anxiety-like behavior in mice. Ecotoxicol Environ. Saf 2023, 259, 115034 DOI: 10.1016/j.ecoenv.2023.115034
  There is no corresponding record for this reference.
13. 13
  He, W.; Gao, Z.; Liu, S.; Tan, L.; Wu, Y.; Liu, J.; Zheng, Z.; Fan, W.; Luo, Y.; Chen, Z.; Song, S. G protein-coupled estrogen receptor activation by bisphenol-A disrupts lipid metabolism and induces ferroptosis in the liver. Environ. Pollut. 2023, 334, 122211 DOI: 10.1016/j.envpol.2023.122211
  There is no corresponding record for this reference.
14. 14
  Lee, I.; Park, Y. J.; Kim, M. J.; Kim, S.; Choi, S.; Park, J.; Cho, Y. H.; Hong, S.; Yoo, J.; Park, H.; Cheon, G. J.; Choi, K.; Moon, M. K. Associations of urinary concentrations of phthalate metabolites, bisphenol A, and parabens with obesity and diabetes mellitus in a Korean adult population: Korean National Environmental Health Survey (KoNEHS) 2015–2017. Environ. Int. 2021, 146, 106227 DOI: 10.1016/j.envint.2020.106227
  There is no corresponding record for this reference.
15. 15
  Geens, T.; Neels, H.; Covaci, A. Distribution of bisphenol-A, triclosan and n-nonylphenol in human adipose tissue, liver and brain. Chemosphere 2012, 87 (7), 796– 802, DOI: 10.1016/j.chemosphere.2012.01.002
  There is no corresponding record for this reference.
16. 16
  Soundararajan, A.; Prabu, P.; Mohan, V.; Gibert, Y.; Balasubramanyam, M. Novel insights of elevated systemic levels of bisphenol-A (BPA) linked to poor glycemic control, accelerated cellular senescence and insulin resistance in patients with type 2 diabetes. Mol. Cell. Biochem. 2019, 458 (1–2), 171– 183, DOI: 10.1007/s11010-019-03540-9
  There is no corresponding record for this reference.
17. 17
  Chiu, H. W.; Chu, C. W.; Huang, C. C.; Chia, Z. C.; Wang, Y. L.; Lee, Y. H. Polystyrene microplastics induce hepatic lipid metabolism and energy disorder by upregulating the NR4A1-AMPK signaling pathway. Environ. Pollut. 2025, 369, 125850 DOI: 10.1016/j.envpol.2025.125850
  There is no corresponding record for this reference.
18. 18
  Wang, W.; Guan, J.; Feng, Y.; Nie, L.; Xu, Y.; Xu, H.; Fu, F. Polystyrene microplastics induced nephrotoxicity associated with oxidative stress, inflammation, and endoplasmic reticulum stress in juvenile rats. Front. Nutr. 2022, 9, 1059660 DOI: 10.3389/fnut.2022.1059660
  There is no corresponding record for this reference.
19. 19
  Li, B.; Ding, Y.; Cheng, X.; Sheng, D.; Xu, Z.; Rong, Q.; Wu, Y.; Zhao, H.; Ji, X.; Zhang, Y. Polyethylene microplastics affect the distribution of gut microbiota and inflammation development in mice. Chemosphere 2020, 244, 125492 DOI: 10.1016/j.chemosphere.2019.125492
  There is no corresponding record for this reference.
20. 20
  Sun, H.; Chen, N.; Yang, X.; Xia, Y.; Wu, D. Effects induced by polyethylene microplastics oral exposure on colon mucin release, inflammation, gut microflora composition and metabolism in mice. Ecotoxicol Environ. Saf 2021, 220, 112340 DOI: 10.1016/j.ecoenv.2021.112340
  There is no corresponding record for this reference.
21. 21
  Jing, J.; Zhang, L.; Han, L.; Wang, J.; Zhang, W.; Liu, Z.; Gao, A. Polystyrene micro-/nanoplastics induced hematopoietic damages via the crosstalk of gut microbiota, metabolites, and cytokines. Environ. Int. 2022, 161, 107131 DOI: 10.1016/j.envint.2022.107131
  There is no corresponding record for this reference.
22. 22
  Zhao, Q. L.; Yang, F.; Pu, Q. Y.; Zhao, R.; Jiang, S.; Tang, Y. P. Integrative metabolomics and gut microbiota analyses reveal the protective effects of DHA-enriched phosphatidylserine on bisphenol A-induced intestinal damage. J. Funct. Foods 2024, 117, 106229 DOI: 10.1016/j.jff.2024.106229
  There is no corresponding record for this reference.
23. 23
  Feng, L.; Chen, S.; Zhang, L.; Qu, W.; Chen, Z. Bisphenol A increases intestinal permeability through disrupting intestinal barrier function in mice. Environ. Pollut. 2019, 254 (Pt A), 112960 DOI: 10.1016/j.envpol.2019.112960
  There is no corresponding record for this reference.
24. 24
  Feng, D.; Zhang, H.; Jiang, X.; Zou, J.; Li, Q.; Mai, H.; Su, D.; Ling, W.; Feng, X. Bisphenol A exposure induces gut microbiota dysbiosis and consequent activation of gut-liver axis leading to hepatic steatosis in CD-1 mice. Environ. Pollut. 2020, 265 (Pt A), 114880 DOI: 10.1016/j.envpol.2020.114880
  There is no corresponding record for this reference.
25. 25
  Pelaseyed, T.; Bergstrom, J. H.; Gustafsson, J. K.; Ermund, A.; Birchenough, G. M.; Schutte, A.; van der Post, S.; Svensson, F.; Rodriguez-Pineiro, A. M.; Nystrom, E. E.; Wising, C.; Johansson, M. E.; Hansson, G. C. The mucus and mucins of the goblet cells and enterocytes provide the first defense line of the gastrointestinal tract and interact with the immune system. Immunol Rev. 2014, 260 (1), 8– 20, DOI: 10.1111/imr.12182
  There is no corresponding record for this reference.
26. 26
  James, K. R.; Gomes, T.; Elmentaite, R.; Kumar, N.; Gulliver, E. L.; King, H. W.; Stares, M. D.; Bareham, B. R.; Ferdinand, J. R.; Petrova, V. N.; Polanski, K.; Forster, S. C.; Jarvis, L. B.; Suchanek, O.; Howlett, S.; James, L. K.; Jones, J. L.; Meyer, K. B.; Clatworthy, M. R.; Saeb-Parsy, K.; Lawley, T. D.; Teichmann, S. A. Distinct microbial and immune niches of the human colon. Nat. Immunol 2020, 21 (3), 343– 353, DOI: 10.1038/s41590-020-0602-z
  There is no corresponding record for this reference.
27. 27
  Wang, L.; Chen, J.; Zhang, X.; Xu, M.; Zhang, X.; Zhao, W.; Cui, J. Effects of microplastics and tetracycline on intestinal injury in mice. Chemosphere 2023, 337, 139364 DOI: 10.1016/j.chemosphere.2023.139364
  There is no corresponding record for this reference.
28. 28
  Ahmad, E.; Lim, S.; Lamptey, R.; Webb, D. R.; Davies, M. J. Type 2 diabetes. Lancet 2022, 400 (10365), 1803– 1820, DOI: 10.1016/S0140-6736(22)01655-5
  There is no corresponding record for this reference.
29. 29
  Saeedi, P.; Petersohn, I.; Salpea, P.; Malanda, B.; Karuranga, S.; Unwin, N.; Colagiuri, S.; Guariguata, L.; Motala, A. A.; Ogurtsova, K.; Shaw, J. E.; Bright, D.; Williams, R.; IDF Diabetes Atlas Committee Global and regional diabetes prevalence estimates for 2019 and projections for 2030 and 2045: Results from the International Diabetes Federation Diabetes Atlas, 9^th edition. Diabetes Res. Clin. Pract. 2019, 157, 107843 DOI: 10.1016/j.diabres.2019.107843
  There is no corresponding record for this reference.
30. 30
  Asgharnezhad, M.; Joukar, F.; Fathalipour, M.; Khosousi, M.; Hassanipour, S.; Pourshams, A.; Mansour-Ghanaei, R.; Mansour-Ghanaei, F. Gastrointestinal symptoms in patients with diabetes mellitus and non-diabetic: A cross-sectional study in north of Iran. Diabetes Metab Syndr 2019, 13 (3), 2236– 2240, DOI: 10.1016/j.dsx.2019.05.028
  There is no corresponding record for this reference.
31. 31
  Kim, J. H.; Park, H. S.; Ko, S. Y.; Hong, S. N.; Sung, I. K.; Shim, C. S.; Song, K. H.; Kim, D. L.; Kim, S. K.; Oh, J. Diabetic factors associated with gastrointestinal symptoms in patients with type 2 diabetes. World J. Gastroenterol 2010, 16 (14), 1782– 1787, DOI: 10.3748/wjg.v16.i14.1782
  There is no corresponding record for this reference.
32. 32
  Abdalla, M. M. I. Enteric neuropathy in diabetes: Implications for gastrointestinal function. World J. Gastroenterol 2024, 30 (22), 2852– 2865, DOI: 10.3748/wjg.v30.i22.2852
  There is no corresponding record for this reference.
33. 33
  Ma, J. W.; Lai, T. J.; Hu, S. Y.; Lin, T. C.; Ho, W. C.; Tsan, Y. T. Effect of ambient air pollution on the incidence of colorectal cancer among a diabetic population: a nationwide nested case-control study in Taiwan. BMJ. Open 2020, 10 (10), e036955 DOI: 10.1136/bmjopen-2020-036955
  There is no corresponding record for this reference.
34. 34
  Zitouni, N.; Bousserrhine, N.; Belbekhouche, S.; Missawi, O.; Alphonse, V.; Boughatass, I.; Banni, M. First report on the presence of small microplastics (≤3 μm) in tissue of the commercial fish Serranus scriba (Linnaeus. 1758) from Tunisian coasts and associated cellular alterations. Environ. Pollut. 2020, 263 (Pt A), 114576 DOI: 10.1016/j.envpol.2020.114576
  There is no corresponding record for this reference.
35. 35
  Senathirajah, K.; Attwood, S.; Bhagwat, G.; Carbery, M.; Wilson, S.; Palanisami, T. Estimation of the mass of microplastics ingested - A pivotal first step towards human health risk assessment. J. Hazard. Mater. 2021, 404 (Pt B), 124004 DOI: 10.1016/j.jhazmat.2020.124004
  There is no corresponding record for this reference.
36. 36
  Cox, K. D.; Covernton, G. A.; Davies, H. L.; Dower, J. F.; Juanes, F.; Dudas, S. E. Human Consumption of Microplastics. Environ. Sci. Technol. 2019, 53 (12), 7068– 7074, DOI: 10.1021/acs.est.9b01517
  There is no corresponding record for this reference.
37. 37
  Qin, S.; Gao, M.; Zhang, Q.; Xiao, Q.; Fu, J.; Tian, Y.; Jiao, Y.; Zhang, Z.; Zhang, P.; Xu, F. High-Coverage Strategy for Multi-Subcellular Metabolome Analysis Using Dansyl-Labeling-Based LC-MS/MS. Anal. Chem. 2023, 95 (26), 10034– 10043, DOI: 10.1021/acs.analchem.3c01343
  There is no corresponding record for this reference.
38. 38
  Baars, D. P.; Fondevila, M. F.; Meijnikman, A. S.; Nieuwdorp, M. The central role of the gut microbiota in the pathophysiology and management of type 2 diabetes. Cell Host Microbe 2024, 32 (8), 1280– 1300, DOI: 10.1016/j.chom.2024.07.017
  There is no corresponding record for this reference.
39. 39
  Takeuchi, T.; Kubota, T.; Nakanishi, Y.; Tsugawa, H.; Suda, W.; Kwon, A. T.; Yazaki, J.; Ikeda, K.; Nemoto, S.; Mochizuki, Y.; Kitami, T.; Yugi, K.; Mizuno, Y.; Yamamichi, N.; Yamazaki, T.; Takamoto, I.; Kubota, N.; Kadowaki, T.; Arner, E.; Carninci, P.; Ohara, O.; Arita, M.; Hattori, M.; Koyasu, S.; Ohno, H. Gut microbial carbohydrate metabolism contributes to insulin resistance. Nature 2023, 621 (7978), 389– 395, DOI: 10.1038/s41586-023-06466-x
  There is no corresponding record for this reference.
40. 40
  Herp, S.; Durai Raj, A. C.; Salvado Silva, M.; Woelfel, S.; Stecher, B. The human symbiont Mucispirillum schaedleri: causality in health and disease. Med. Microbiol Immunol 2021, 210 (4), 173– 179, DOI: 10.1007/s00430-021-00702-9
  There is no corresponding record for this reference.
41. 41
  Liu, J.; Zhao, B.; Wang, L.; Zhang, W.; Zan, T.; Chen, Z.; Li, Y. Occurrence, fate, and transport of N-nitrosamines and precursors in sewage treatment plants and receiving rivers in a highly urbanized basin. Environ. Pollut. 2025, 368, 125808 DOI: 10.1016/j.envpol.2025.125808
  There is no corresponding record for this reference.
42. 42
  Behera, S.; Das, S. Potential and prospects of Actinobacteria in the bioremediation of environmental pollutants: Cellular mechanisms and genetic regulations. Microbiol Res. 2023, 273, 127399 DOI: 10.1016/j.micres.2023.127399
  There is no corresponding record for this reference.
43. 43
  Bao, L.; Cui, X.; Zeng, T.; Liu, G.; Lai, W.; Zhao, H.; Gao, F.; Wu, J.; Leong, K. W.; Chen, C. Incorporation of polylactic acid microplastics into the carbon cycle as a carbon source to remodel the endogenous metabolism of the gut. Proc. Natl. Acad. Sci. U. S. A. 2025, 122 (19), e2417104122 DOI: 10.1073/pnas.2417104122
  There is no corresponding record for this reference.
44. 44
  Zhang, K.; Yang, J.; Chen, L.; He, J.; Qu, D.; Zhang, Z.; Liu, Y.; Li, X.; Liu, J.; Li, J.; Xie, X.; Wang, Q. Gut Microbiota Participates in Polystyrene Microplastics-Induced Hepatic Injuries by Modulating the Gut-Liver Axis. ACS Nano 2023, 17 (15), 15125– 15145, DOI: 10.1021/acsnano.3c04449
  There is no corresponding record for this reference.
45. 45
  Ni, Y.; Hu, L.; Yang, S.; Ni, L.; Ma, L.; Zhao, Y.; Zheng, A.; Jin, Y.; Fu, Z. Bisphenol A impairs cognitive function and 5-HT metabolism in adult male mice by modulating the microbiota-gut-brain axis. Chemosphere 2021, 282, 130952 DOI: 10.1016/j.chemosphere.2021.130952
  There is no corresponding record for this reference.
46. 46
  DeLuca, J. A.; Allred, K. F.; Menon, R.; Riordan, R.; Weeks, B. R.; Jayaraman, A.; Allred, C. D. Bisphenol-A alters microbiota metabolites derived from aromatic amino acids and worsens disease activity during colitis. Exp Biol. Med. (Maywood) 2018, 243 (10), 864– 875, DOI: 10.1177/1535370218782139
  There is no corresponding record for this reference.
47. 47
  Chen, Y.; Mai, Q.; Chen, Z.; Lin, T.; Cai, Y.; Han, J.; Wang, Y.; Zhang, M.; Tan, S.; Wu, Z.; Chen, L.; Zhang, Z.; Yang, Y.; Cui, T.; Ouyang, B.; Sun, Y.; Yang, L.; Xu, L.; Zhang, S.; Li, J.; Shen, H.; Liu, L.; Zeng, L.; Zhang, S.; Zeng, G. Dietary palmitoleic acid reprograms gut microbiota and improves biological therapy against colitis. Gut Microbes 2023, 15 (1), 2211501 DOI: 10.1080/19490976.2023.2211501
  There is no corresponding record for this reference.
48. 48
  Yang, J.; Liu, S.; Zhao, Q.; Li, X.; Jiang, K. Gut microbiota-related metabolite alpha-linolenic acid mitigates intestinal inflammation induced by oral infection with Toxoplasma gondii. Microbiome 2023, 11 (1), 273, DOI: 10.1186/s40168-023-01681-0
  There is no corresponding record for this reference.
49. 49
  Bahreyni, A.; Samani, S. S.; Khazaei, M.; Ryzhikov, M.; Avan, A.; Hassanian, S. M. Therapeutic potentials of adenosine receptors agonists and antagonists in colitis; Current status and perspectives. J. Cell Physiol 2018, 233 (4), 2733– 2740, DOI: 10.1002/jcp.26073
  There is no corresponding record for this reference.
Supporting Information
Supporting Information
The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acs.chemrestox.5c00359.
- Figure S1. Colonic inflammatory factors expression in T2D mice. Figure S2. Organ coefficient and FBG in T2D mice with PS-MPs/BPA exposure. Figure S3. Colonic inflammatory factors expression in T2D mice with PS-MPs/BPA exposure. Figure S4. Colonic protein expression in T2D mice with PS-MPs/BPA exposure. Figure S5. Linear discriminant analysis effect size (LEfSe) comparing the Control and T2D groups. Figure S6. Metabolomics analysis in T2D mice with PS-MPs/BPA exposure. Table S1. Metabolite retention time and MRM parameters. Table S2. Intestinal differential metabolites between groups (PDF)
- tx5c00359_si_001.pdf (1.04 MB)
Terms & Conditions

Most electronic Supporting Information files are available without a subscription to ACS Web Editions. Such files may be downloaded by article for research use (if there is a public use license linked to the relevant article, that license may permit other uses). Permission may be obtained from ACS for other uses through requests via the RightsLink permission system: http://pubs.acs.org/page/copyright/permissions.html.

Polystyrene Microplastics and Bisphenol A Exposure Worsen Intestinal Injury in Diabetic Mice by Disrupting Gut Microbiota and MetabolitesClick to copy article linkArticle link copied!

Chemical Research in Toxicology

Abstract

1. Introduction

2. Experimental Procedures

2.1. Chemicals and Reagents

2.2. Cell Culture and Treatment

2.3. Animal Experiments and Dose Selection

2.3.1. Dose Selection

2.3.2. Animal Experiment

2.4. Western Blot Analysis

2.5. Metabolomics Analysis

2.6. 16S rRNA Gene Sequencing

2.7. Histopathologic Analysis

2.8. Statistical Analysis

3. Results

3.1. T2D Mice Exhibit Mild Gut Injury

Figure 1

3.2. PS-MPs and BPA Exposures Promote Intestinal Injury in T2D Mice

Figure 2

3.3. PS-MPs and BPA Exposures Alter Gut Microbiota in T2D Mice

Figure 3

3.4. PS-MPs and BPA Exposures Induce Colonic Metabolic Dysregulations in T2D Mice

Figure 4

3.5. Intestinal Metabolic Dysregulation Is Linked to Gut Damage in T2D Mice with PS-MPs Exposure

Figure 5

3.6. Altered Metabolites Promote the Expression of Gut Barrier Proteins In Vitro

Figure 6

3.7. Gut Microbiota Dysbiosis Is Closely Correlated to Colonic Metabolic Alterations

Figure 7

4. Discussion

5. Conclusions

Supporting Information

Terms & Conditions

Author Information

Acknowledgments

Abbreviations

References

Cited By

Chemical Research in Toxicology

Article Views

Altmetric

Citations

Recommended Articles

Abstract

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5

Figure 6

Figure 7

References

Supporting Information

Supporting Information

Terms & Conditions

Polystyrene Microplastics and Bisphenol A Exposure Worsen Intestinal Injury in Diabetic Mice by Disrupting Gut Microbiota and Metabolites
Click to copy article linkArticle link copied!